Cilostazol Prevents Tumor Necrosis Factor- -Induced Cell Death by Suppression of Phosphatase and Tensin Homolog Deleted from Chromosome 10 Phosphorylation and Activation of Akt/Cyclic AMP Response Element-Binding Protein Phosphorylation

This study examines the signaling mechanism by which cilostazol prevents neuronal cell death. Cilostazol ( 0.1–100 M) prevented tumor necrosis factor(TNF)-induced decrease in viability of SK-N-SH and HCN-1A cells, which was antagonized by 1 M iberiotoxin, a maxi-K channel blocker. TNFdid not suppress the viability of the U87-MG cell, a phosphatase and tensin homolog deleted from chromosome 10 (PTEN)-null glioblastoma cell, but it did decrease viability of U87-MG cells transfected with expression vectors for the sense PTEN, and this decrease was also prevented by cilostazol. Cilostazol as well as 1,3-dihydro-1-[2-hydroxy-5-(trifluoromethyl)phenyl]-5(trifluoromethyl)-2H-benzimidazol-2-one (NS-1619) and (3S)( )-(5-chloro-2-methoxyphenyl)-1,3-dihydro-3-fluoro-6-(trifluoromethyl)-2H-indole-2-one (BMS 204352), maxi-K channel openers, prevented increased DNA fragmentation evoked by TNF, which were antagonizable by iberiotoxin. TNFinduced increased PTEN phosphorylation and decreased Akt/ cyclic AMP response element-binding protein (CREB) phosphorylation were significantly prevented by cilostazol, those of which were antagonized by both iberiotoxin and paxilline, maxi-K channel blockers. The same results were evident in U87-MG cells transfected with expression vectors for sense PTEN. Cilostazol increases the K current in SK-N-SH cells by activating maxi-K channels without affecting the ATP-sensitive K channel. Thus, our results for the first time provide evidence that cilostazol prevents TNF-induced cell death by suppression of PTEN phosphorylation and activation of Akt/CREB phosphorylation via mediation of the maxi-K channel opening. Recent research has shown that the phosphatase and tensin homolog deleted from chromosome 10 (PTEN) is implicated in the regulation of several cellular functions, including cell viability from apoptosis (Li et al., 1998; Stambolic et al., 1998; Cantley and Neel, 1999). PTEN is capable of dephosphorylating both phospho-tyrosine and phospho-serine/threonine-containing substrates (Myers et al., 1997) and also of dephosphorylating the phosphatidylinositol-3,4,5-triphosphate [PI(3,4,5)P3], a direct product of phosphatidylinositol 3-kinase (PI3-K) activity, thereby converting the PI(3,4,5)P3 to phosphatidylinositol 3,4diphosphate [PI(3,4)P2], an inactive state (Maehama and Dixon, 1998; Stambolic et al., 1998). Huang et al. (2001) have demonstrated that transient transfection of PTEN into the PTEN-null cells results in decrease in Bcl-2 mRNA and protein, and loss of PTEN leads to up-regulation of the Bcl-2 gene. Overexpression of PI3-K and its downstream effector Akt (serine/threonine kinase) have been documented to mediate growth factor-induced neuronal survival (Crowder and Freeman, 1998) and to up-regulate Bcl-2 promoter activity associated with increased Bcl-2 This study was supported by funds from the Research Institute of Genetic Engineering (Pusan National University) and the Research Funds from Korea Otsuka Pharmaceutical Co. Ltd. Article, publication date, and citation information can be found at http://jpet.aspetjournals.org. DOI: 10.1124/jpet.103.052365. ABBREVIATIONS: PTEN, phosphatase and tensin homolog deleted from chromosome 10; PI(3,4,5)P3, phosphatidylinositol 3,4,5-triphosphate; PI3-K, phosphatidylinositol 3-kinase; PI(3,4)P2, phosphatidylinositol 3,4-diphosphate; CREB, cyclic AMP response element-binding protein; p-PTEN, phosphorylated PTEN; p-Akt and p-CREB, phosphorylated Akt and CREB; sPTEN, transfected with expression vectors for sense PTEN; MEM, minimal essential medium; bp, base pair(s); MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; NS-1619, 1,3-dihydro-1[2-hydroxy-5-(trifluoromethyl)phenyl]-5-(trifluoromethyl)-2H-benzimidazol-2-one; BMS 204352, (3S)-( )-(5-chloro-2-methoxyphenyl)-1,3-dihydro3-fluoro-6-(trifluoromethyl)-2H-indole-2-one. 0022-3565/03/3063-1182–1190$7.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 306, No. 3 Copyright © 2003 by The American Society for Pharmacology and Experimental Therapeutics 52365/1087472 JPET 306:1182–1190, 2003 Printed in U.S.A. 1182 at A PE T Jornals on July 6, 2017 jpet.asjournals.org D ow nladed from protein through enhanced cyclic AMP response elementbinding protein (CREB) activation (Pugazhenthi et al., 2000). On the other hand, potassium channel is one of the key players in the control of neuronal excitability. The maxi-K channels, large conductance calcium-activated K channels, are activated by depolarization and increased intracellular calcium (Latorre et al., 1989). During ischemia, K channel opener was reported to reduce neurotransmitter release by suppressing accumulation of pathological levels of Ca , thereby significantly attenuating the ischemic injury (Robitaille and Charlton, 1992). Recent studies have documented that BMS 204352, a maxi-K channel opener, protect neuronal cells from acute damage under conditions that cause excessive depolarization and accumulation of intracellular Ca , such as brain ischemia (Gribkoff et al., 2001). Cilostazol was first introduced to increase the intracellular level of cyclic AMP by blocking its hydrolysis by type III phosphodiesterase (Kimura et al., 1985). Recently, Kim et al. (2002) have addressed the in vitro inhibition of lipopolysaccharide-induced apoptosis by cilostazol in human umbilical vein endothelial cells, in that they demonstrated a reversal by cilostazol of the lipopolysaccharide-induced decrease in Bcl-2 protein and the increase in Bax protein and cytochrome c release. Furthermore, Choi et al. (2002) have confirmed the in vivo preventive effect of cilostazol against cerebral infarct evoked by middle cerebral artery occlusion and reperfusion via its antiapoptotic action. Given that cilostazol electrophysiologically increases the calcium-activated K currents in the SK-N-SH cells, we assessed in this study the suppressive effect of cilostazol on the PTEN phosphorylation in relation to cell viability in the absence and presence of iberiotoxin, a maxi-K channel blocker, in the SK-N-SH (human neuroblastoma) and HCN-1A cells (human cortical neuron). Furthermore, we simulate the interaction of cilostazol and iberiotoxin with respect to changes in p-PTEN and p-CREB levels in response to the introduction of TNFin U87-MG cells (human brain PTEN-null glioblastoma) transfected with expression vectors for sense PTEN (sPTEN). Materials and Methods Cell Cultures. SK-N-SH cells (KCLB 30011, human brain neuroblastoma), HCN-1A cells (ATCC CRL-10442, human brain cortical cells) and U87-MG (KCLB 30014, human brain PTEN-null glioblastoma) cells were cultured in Eagle’s minimal essential medium (MEM) with 2 mM L-glutamine and 1.0 mM sodium pyruvate supplemented with 10% heat-inactivated fetal bovine serum. Cells were grown to confluence at 37°C in 5% CO2. Plasmid Construction. The expression of plasmid encoding the human PTEN protein was cloned by reverse transcription-polymerase chain reaction using the total RNA of SK-N-SH cells. Sequence analysis was performed to confirm the nucleotide sequences. The following sequences of oligodeoxynucleotides were used as primers containing linker recognizable by XhoI as underlined: sense, 5 GCGCTCGAGATGACAGCCATCAAA G-3 . Amplified 1264-bp fragments containing the human PTEN coding region were ligated into the XhoI site of pcDNA3.1 HisC (Invitrogen, San Diego, CA). pcDNA3.1-sPTEN is transcripted sense nucleotide. DNA Transfection and Transfection Efficiency Assay. U87-MG cells were seeded for 24 h before transfection in tissue culture dishes. At 50 to 70% confluence, the dishes were washed twice with Opti-MEM medium, to remove the fetal bovine serum, and a transfection cocktail containing 10 g of DNA and 10 l of LipofectAMINE reagent (Invitrogen) per 100-mm dish was added. The medium was removed and then 7 ml of MEM medium containing 10% fetal bovine serum was added to each dish. The -galactosidase assay was performed 36 h after transfection using a commercially available -Gal staining kit (Invitrogen). Under microscope (200 total magnitude), the blue-colored cells were counted in 5 to 10 random fields of view and the transfection efficiency was estimated. In the U87-MG cells transfected with expression vectors for sPTEN, the efficiency of transfection was estimated to be over 70% with enhanced expression of PTEN protein. Cell Viability Assay. According to the mitochondrial tetrazolium assay (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; MTT) procedure, cells were seeded 1 10 cells/well in 96-well tissue culture plates. The confluent cells received MEM medium with 1% fetal bovine serum plus drugs 3 h before stimulation with TNFand then were exposed to TNFfor 24 h. After incubation, 20 l/well of MTT solution (5 mg/ml phosphate-buffered saline) was added and incubated for 2 h. The medium was aspirated and replaced with 150 l/well of ethanol/dimethyl sulfoxide solution (1:1). The optical density was measured at 570 to 630 nm using ELISA reader (Bio-Tek Instruments, Inc., Winooski, VT). DNA Fragmentation Assay. After incubation in the absence and presence of the drugs for 3 h, cells (1–5 10) were exposed to TNF(50 ng/ml) for 24 h. At harvest, trypsinized cells were pelleted by centrifugation. Cells were lysed in 1 ml of lysis buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% sodium dodecyl sulfate, and 0.5 mg/ml proteinase K). Digestion was continued for 1 to 3 h at 55°C, followed by addition of RNase A to 0.1 mg/ml and running dye (10 mM EDTA, 0.25% bromphenol blue, and 50% glycerol). Equivalent amounts of DNA (15–20 g) were loaded into wells of 1.6% agarose gel and electrophoresed in 0.5 TAE buffer (40 mM Tris-acetate and 1 mM EDTA) for 2 h at 6 V/cm. DNA was visualized by ethidium bromide staining. Gel pictures were taken by UV transillumination with a Polaroid camera. Western Blot Analysis. The confluent cells received MEM medium with 1% fetal bovine serum plus cilostazol 3 h before stimulation with TNFand then were exposed to TNFfor 1 h. The cells were lysed in lysis buffer containing 50 mM Tris-Cl (pH 8.0), 150 mM NaCl, 0.02% sodium azide, 100 g/ml phenylmethylsulfonyl fluoride, 1 g/ml aprotinin, and 1% Triton X-100. After centrifugation at 12,000 rpm, 50 g of total protein was loaded into 8 or 10% SDSpolyacrylamide gel electrophoresis gel, and transferred to nitrocellulose membrane (Amersham Biosciences, Inc., Piscataway, NJ). The blocked membranes were then incubated with the indicated antibody, and the immunoreactive bands were visualized using chemiluminescent reagent as recommended by the Supersignal West Dura Extended Duration Substrate kit (Pierce Chemical, Rockford, IL). The signals of the bands were quantified using the GS-710 Calibrated imaging densitometer (Bio-Rad, Hercules, CA). The results were expressed as a relative density. Polyclonal antibodies against maxi-K channel -subunit, CREB, p-CREB, and monoclonal antibodies against Bcl-2 and Bax were from the Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Polyclonal antibodies against PTEN, p-PTEN (Ser380/Thr382/383), Akt, and p-Akt (Ser473) were from the Cell Signaling Technology, Inc. (Beverly, MA). Recording of the Whole-Cell K Current. Experiments were performed in the small bath (0.5 ml) mounted on the stage of an inverted microscope (model TE300; Nikon, Tokyo, Japan) perfused continuously at a flow rate of 1 ml/min. Using the whole-cell configuration of the patch-clamp technique, the K currents were recorded at room temperature (20–22C) with the Axopatch-200B patchclamp amplifier (Axon Instruments, Inc., Foster City, CA). Currents were sampled at 1 to 10 kHz after anti-alias filtering at 0.5 to 5 kHz. Data acquisition and command potentials were controlled by pClamp 6.0.3 software (Axon Instruments, Inc.). To ensure voltage-clamp quality, electrode resistance was kept below 3 M . Junction potentials were zeroed with the electrode in the standard bath solution. Gigaohm seal formation was achieved by suction and, after estabInhibition of Neuronal Cell Death by Cilostazol 1183 at A PE T Jornals on July 6, 2017 jpet.asjournals.org D ow nladed from lishing the whole-cell configuration, the capacitive transients elicited by symmetrical 10-mV voltage-clamp steps from 80 mV were recorded at 50 kHz for calculation of cell capacitance. The normal bath solution (millimolar) for the whole-cell recordings was 130 mM NaCl, 5 mM KCl, 1.2 mM MgCl2, 1.8 mM CaCl2 1.8, 10 mM HEPES, and 5.2 mM glucose; pH was adjusted to 7.4 with NaOH. Pipettes were filled with 140 mM KCl, 0.5 mM MgCl2, 0.1 mM CaCl2, 0.09 mM EGTA, 10 mM HEPES, and 10 mM glucose; pH was adjusted to 7.4